As A Rule Of Thumb, Don't Reblog Donation Posts Or People Asking For Donations Unless They've Been Vetted

new job has given me a lot more time to doodle! have a bnuuy

Briana Boston faces terrorism charges and CEOs are getting free therapy

Briana Boston is a 42 year old mother of three from Florida who is under house arrest for expressing her frustration at her insurance (which she PAYS for) who denied her claim. She owns ZERO guns and doesn't have a criminal record.

She was originally held in prison for $100,000 bail. They have not dropped the charges and she is under house arrest even after widespread backlash.

They are trying to charge her with terrorism. They want her to spend 15 years in prison.

They are calling her a Luigi Mangione copycat. As if she killed someone. She made a indirect, not at all credible threat.

Meanwhile...

I want every woman who has ever faced threats online, stalking, etc to bring this Briana Boston up at every opportunity. Every time you were told by police that there was nothing they could do, know that they not only CAN do something, but they WILL do something, just not for you.

so I've been sitting on the finished version of my bnuuy for months now. I figured it was finally time to post it :3

ignore all the shitpost practice sketches

she genetic code on my genome till i GATATATAGGACTAGATAGTA

i’m so glad earth only has one moon, if there were more i’d have to pick a favorite and that sounds too emotionally taxing to even fathom

Verified Palestinian gofundme’s Masterlist

Rightfully so, I have gotten messages worrying if everything I post is legit (I try my best to make sure the answer is yes), but here’s a masterlist of ones that one or more people have confirmed are legit Palestinians. Most are from the blogs @el-shab-hussein, @ibtisams, @palestinecharitycommissionsassoc ,@90-ghost, @nabulsi and @palipunk

I will also be making individual posts for most of these

Help Khaled and his family escape Gaza

Help lara and abdalla Family to be safe in Gaza

Emergency: Help Ibrahim's Family Find Safety - $50 is 500kr

HELP Ezzideen & his Family to EVACUATE Gaza

Your help is the only hope to save us from war.

Hope : Help Little Elen Fetch a brighter Future

Help Aseel’s family evacuate from Gaza.

EMERGENCY: HELP evacuate Bashar from Gaza

Help Mohammad Hammad evacuate his family from Gaza

Help Madleen's Family From Gaza

Help Jehad Evacute From Gaza

Help a med student & his family evacuate to safety

Help Fadi's Family Rebuild Their Life Amidst Crisis

Help Us Safely Evacuate a family from Gaza

Help child with Cerebral Palsy evacuate

Protect an open source engineer and his family

Help Bring Ayah’s Family in Gaza to Safety

Call to Action: Keep Gazas Talent Alive

Help Belal and His Family Escape the War in Gaza

Urgent Rescue Mission for the Mortaja Family

Save my family from the war in Gaza

Urgent: Help Evacuate My Family From Gaza War

Urgent help to evacuate my family out of Gaza

Help evacuate Safi’s family from Gaza in warfare

emergency : Help Support the Khalaf Family in Gaza

Help AbdulAziz and his family

Help Yousef escape Gaza and treat his cancer

Help my family rebuild home und evacuate Gaza

Please Help Me Evacuate My Children To Safety

Escape From War Nightmare: Support Gazan Family

Help my family in Gaza

Salaam Animal Care, find a safe home for animals

URGENT HELP help my family to evacuate Gaza

Help me & my Family Evacuate from Gaza

Urgent Appeal for Support: Help a Photographer

Help Jana's Family Find Refuge and Peace

Help me to save my family from the war in Gaza

Help evacuate my brother and his family from Gaza

Urgent apeal to help Elzomar family leave Gaza immediately

Help my mum to travel to a safe place

Help Afnan to find safety and to complete her education

Support getting Linda and her family out of Gaza

Support Mohammed and His Family Affected by the Gaza War

Help Ala's Family Overcome Crisis in Gaza

Freedom and home repair for Aesha an family

Help us evacuate and rebuild what's left of our lives

Help Tamer and his Family in Gaza!

Help my family escape death and reunite with me.

Help me and my family escape the Genocide in Gaza

Help rebuild Ahmed's family life in Gaza .

Emergency : Saving My Mother and only brother From War Zone

Rescue Mahmoud's Family: A Call to Escape Gaza's Devastation

Help Mohammed & His Family To Safety

Help Almoghrabi family to evacuate Gaza strip

Urgent Appeal: Help Save Ruba & Muhammad in Gaza!

Urgent help to evacuate my family from Gaza

Help Alia's family and their children get out of Gaza

Urgent Appeal: Save Little Yusuf and His Family Amidst Gaza

Support My Family Escape War in Gaza

Help me get my family out to safety

Help my family out of Gaza

Help me get my family out to safety

Help my children and family from the Gaza war !!

Please Help Evacuate Fadi's Family from Gaza

URGENT: Help Hayam and her Family Escape the Genocide

For what remained in us من أجل ما تبقى فينا

Please Help Restore The Sharifs home & Help Leave A War Zone

Help Shymaa's Family Reunite in Egypt

Help Mahmoud’s family evacuate from Gaza

Donate to help Deyaa and his family escape Gaza

Fatima’s Journey to Restore Artistry in Gaza

My family under fire, help them evacuate Gaza.

Help me to evacuate from the genocide

Help Mahmoud to evacuate from Gaza to continue education

Help my family evacuate from Gaza

Help Sana’a and her family evacuate from Gaza

Haytham needs your help to support his family

Help my family survive and evacuate from Gaza

Help me rebuild a shelter for my family in Rafah

HelpYoussef and his family get out of Gaza for a better life

Let my family be safe and live in peace!

Relief Appeal: Secure Evacuation from Gaza War

Please Help Tahani save her children and husband

Urgent Help Appeal: exit the war of Gaza"

Help My Family Get Out Of Gaza

Vegetables, food, and water for Palestinian families

HELP Muhammad evacuate his family out of GAZA

Secure a Safe Future for Youssef’s Family - Act now

Support My Journey to a New Start

Help Shymaa's Family Reunite in Egypt

Help Me and my Family to evacuate from Gaza ASAP

Saving My Family from the Horrors of War in Gaza

Help the Allahawani family escape genocide

URGENT - Help Azzam evacuate his family from Gaza

help my children get out of gaza safely

Emergency: Help Evacuate My Family from Gaza

Help Safaa secure her children‘s lives after war

Help Kareem get his family from Gaza to safety

Help Karim and his family get to a safe place

reblogging to save this pattern i NEED to make this

Everyone look at the cat blanket I made like .. 3 years ago

Momo! | Stray

I've been replaying Stray. Momo my beloved

this was meant to be a practice sketch, but I got a little carried away

process under the cut

my FFXIV oc!

coloring wip of my bnuuy! I'm trying to practice my rendering and work on faces :3

coloring skin is hard :(

wip of sebward from sdv! finally drawing again