I Should Really Start Signing My Art But It's So Funny Seeing It Out In The Wild And Seeing People Question

I should really start signing my art but it's so funny seeing it out in the wild and seeing people question its origins

More Posts from Rennaisseance and Others

1 year ago

STOP. DON'T SCROLL. READ THIS TO SAVE LIVES IN GAZA. Below are some VETTED campaigns to support Gazans. These people have been experiencing an active genocide for almost a full year. Donate and share widely.

(may 27th)

Support Fahmi and his family (@fahmiakkila) - Fahmi's life has been turned completely upside down, and he now finds himself responsible to save his parents, sisters, & brothers - 7 members.

Save the Maliha family (@dinamaliha) - Dina wants to save her mother, two sisters, and three brothers. The family lost contact with their father when the genocide started. They desperately need to get to Egypt.

Save Firas' family (@firassalemnewacccount @prosolitudeeee) - Firas is a father of two children, a 10-month-old boy and a two-year-old girl, who are in need of safe haven in Egypt.

Help Husam and his family (@husamthaher) - Husam desperately needs to save himself, his wife, and 3 young children.

Help Nader's family to evacuate from Gaza (@nadershoshaa) - Nader and his family, consisting of six members, are currently displaced in the south; help them evacuate and survive.

The Shamaly family wants to survive (@daee571989) - Help save 15 kids and their family, who are living a horrifying active genocide:

Ahmd needs urgent evacuation (@ahmd-iyd) - Ahmd has lost his livelihood to this genocide, and needs funds to help his family evacuate and rebuild their life.

Help evacuate Hani's family (@skatehani) - A dear friend, and a Palestinian skater trying to evacuate 10 members of his family; he has lost his father to injustice.

Help Iman’s family find safety (@imaneyad) - Iman has a family of 7 who need to find safety.

Help save Youssef's family (@bba3lo @mahmoud7878) - Ahmed Baalousha wants to save his wife, his two sons, his daughter, as well as his parents and siblings.

Support Ruba and Amal's family's urgent evacuation (@rubashaban @amalshabn) - Ruba and Amal's family are lacking the basic necessities of life; they have an elderly father who desperately needs to be evacuated for medical care.

Save little Yusuf and his family (@ahmednabubake) - Yusuf is in an intensive care unit fighting for his life in Gaza; he needs urgent evacuation alongside his family.

Help Belal and his family to evacuate from Gaza (@alaajshaat) - Belal has lost too much to this war and needs to support himself and his family.

Do not scroll past this list without contributing. This list makes it easy for you to find a fundraiser to support. Choose at least one. Your contribution will save lives. If you cannot donate, share these campaigns.

FIND MORE CAMPAIGNS HERE

6 months ago
Feeesh

Feeesh

7 months ago

i’m so glad earth only has one moon, if there were more i’d have to pick a favorite and that sounds too emotionally taxing to even fathom

1 year ago

This is very urgent so please share however you can. Islam, the mom of this family in Gaza, is eight months pregnant but has a fractured pelvis and therefore cannot give birth safely. She needs a C-section, but the conditions to perform those no longer exist in Gaza. For months women in Gaza have been getting C-sections without anaesthesia. We need to get her out before she goes into labor, which could happen at any time now. We're halfway through the goal and even if everyone just chipped in 5-10 dollars it adds up quick!

Their GFM

This Is Very Urgent So Please Share However You Can. Islam, The Mom Of This Family In Gaza, Is Eight

This Is Very Urgent So Please Share However You Can. Islam, The Mom Of This Family In Gaza, Is Eight
4 months ago

My mother survived the genocide in Cambodia. Her father, my grandfather, was killed due to their neighbors snitching out of jealousy that her family still had some small amount of livestock.

They didn’t receive shit in return for snitching, and honestly they probably died in the genocide too.

Just something to think about.

Its about to be real lucrative to be a snitch. Guard your information. And guard your friends information.

1 year ago
A Wip That I Have Literally Been Working On For WEEKS, I Am Chomping At The Bit And Foaming At The Mouth

a wip that i have literally been working on for WEEKS, i am chomping at the bit and foaming at the mouth for fem hrothgar


Tags
6 months ago
Momo! | Stray

Momo! | Stray

I've been replaying Stray. Momo my beloved

this was meant to be a practice sketch, but I got a little carried away

process under the cut

6 months ago

reblogging to save this pattern i NEED to make this

Everyone Look At The Cat Blanket I Made Like .. 3 Years Ago

Everyone look at the cat blanket I made like .. 3 years ago

6 months ago
In Sonic Adventure 2′s Security Hall Level There’s A Bunch Of Money Flowing About Freely. This Is

In Sonic Adventure 2′s Security Hall level there’s a bunch of money flowing about freely. This is the texture used on that money. [Sonic The Hedgeblog] [Support us on Patreon]  

5 months ago

she genetic code on my genome till i GATATATAGGACTAGATAGTA

  • springborn
    springborn liked this · 1 month ago
  • randomtheidiot
    randomtheidiot liked this · 1 month ago
  • apostaticlamb
    apostaticlamb reblogged this · 2 months ago
  • cryingunderthewaterfall
    cryingunderthewaterfall liked this · 2 months ago
  • lordoflerion
    lordoflerion liked this · 2 months ago
  • ludicrouscheeseburger
    ludicrouscheeseburger reblogged this · 2 months ago
  • doctorfurbenstein
    doctorfurbenstein liked this · 2 months ago
  • rawdogimus-prime
    rawdogimus-prime reblogged this · 2 months ago
  • rawdogimus-prime
    rawdogimus-prime liked this · 2 months ago
  • awaagas
    awaagas liked this · 2 months ago
  • lex015
    lex015 liked this · 2 months ago
  • daily-kanamafu-vitamins
    daily-kanamafu-vitamins liked this · 2 months ago
  • milorrito777
    milorrito777 liked this · 2 months ago
  • o-birdseed-o
    o-birdseed-o liked this · 2 months ago
  • queermentaldisaster
    queermentaldisaster reblogged this · 2 months ago
  • gay-stardrake
    gay-stardrake reblogged this · 2 months ago
  • puppyknucklezzz
    puppyknucklezzz liked this · 2 months ago
  • krusavech
    krusavech reblogged this · 2 months ago
  • gh0str3c0rd3d
    gh0str3c0rd3d reblogged this · 2 months ago
  • gh0str3c0rd3d
    gh0str3c0rd3d liked this · 2 months ago
  • ninja-grace
    ninja-grace liked this · 2 months ago
  • our-happy-end1ng
    our-happy-end1ng reblogged this · 2 months ago
  • linktothecats
    linktothecats reblogged this · 2 months ago
  • aceclipse
    aceclipse reblogged this · 2 months ago
  • kindajustheretbh
    kindajustheretbh liked this · 2 months ago
  • roller-rink-haruno
    roller-rink-haruno liked this · 2 months ago
  • eivor-wolfkissed
    eivor-wolfkissed reblogged this · 2 months ago
  • eivor-wolfkissed
    eivor-wolfkissed liked this · 2 months ago
  • buriedpentacles
    buriedpentacles liked this · 2 months ago
  • marzley-kazmark
    marzley-kazmark reblogged this · 2 months ago
  • overdrift
    overdrift liked this · 2 months ago
  • the-watchful-metatron
    the-watchful-metatron reblogged this · 2 months ago
  • cruithne3753
    cruithne3753 reblogged this · 2 months ago
  • buckaroony
    buckaroony reblogged this · 2 months ago
  • fabled-skies
    fabled-skies reblogged this · 2 months ago
  • mbdoodles
    mbdoodles liked this · 2 months ago
  • anobeko
    anobeko liked this · 2 months ago
  • d20witch
    d20witch liked this · 2 months ago
  • evelynnnnn
    evelynnnnn reblogged this · 2 months ago
  • evelynnnnn
    evelynnnnn liked this · 2 months ago
  • lemanzanabizarra
    lemanzanabizarra reblogged this · 2 months ago
  • lemanzanabizarra
    lemanzanabizarra liked this · 2 months ago
  • derpytoez
    derpytoez reblogged this · 2 months ago
  • holographic-fur
    holographic-fur liked this · 2 months ago
  • morphinez
    morphinez liked this · 2 months ago
  • agentduckorico
    agentduckorico reblogged this · 2 months ago
  • agentduckorico
    agentduckorico liked this · 2 months ago
  • stormcrow513
    stormcrow513 liked this · 2 months ago
  • bowldrips
    bowldrips reblogged this · 2 months ago
  • file-cabinets
    file-cabinets liked this · 2 months ago
rennaisseance - Viv’s Shitpost Dumpster Fire
Viv’s Shitpost Dumpster Fire

Viv | She/her

90 posts

Explore Tumblr Blog
Search Through Tumblr Tags